
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
igdcc3
- Ensembl ID:
- ENSDARG00000075158
- ZFIN ID:
- ZDB-GENE-080303-24
- Description:
- immunoglobulin superfamily, DCC subclass, member 3 [Source:RefSeq peptide;Acc:NP_001091714]
- Human Orthologue:
- IGDCC3
- Human Description:
- immunoglobulin superfamily, DCC subclass, member 3 [Source:HGNC Symbol;Acc:9700]
- Mouse Orthologue:
- Igdcc3
- Mouse Description:
- immunoglobulin superfamily, DCC subclass, member 3 Gene [Source:MGI Symbol;Acc:MGI:1202390]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa34100 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa34099 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa34100
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111388 | Essential Splice Site | 315 | 773 | 6 | 14 |
- Genomic Location (Zv9):
- Chromosome 7 (position 32864673)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 31259013 GRCz11 7 31530163 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCAGGAACACGAGTGCGCAGAACTGCTCAGGGACTCCTAGTTGTGCAAGG[T/C]GAGGCTTTTTGGGTACAAAACTATGAACTTAATATTTGTCTATTGAAATC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34099
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111388 | Nonsense | 636 | 773 | 12 | 14 |
- Genomic Location (Zv9):
- Chromosome 7 (position 32839201)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 31233541 GRCz11 7 31504691 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAAAGCTCCACCACAGGCATCATCATCGGCATCCACATAGGAGTCACTTG[C/A]ATCATTTTCTGTGTCCTATTCCTCATGTTCAGCTACAGGGGCAGGTGAGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: