zgc:165534

Ensembl ID:
ENSDARG00000075149
ZFIN ID:
ZDB-GENE-070928-4
Description:
hypothetical protein LOC569719 [Source:RefSeq peptide;Acc:NP_001103185]
Human Orthologue:
NAGPA
Human Description:
N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase [Source:HGNC Symbol;Acc:17378]
Mouse Orthologue:
Nagpa
Mouse Description:
N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase Gene [Source:MGI Symbol;Acc:MGI:1

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36220 Essential Splice Site Mutation detected in F1 DNA During 2018
sa36221 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36220
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126129 Essential Splice Site 190 586 2 11
Genomic Location (Zv9):
Chromosome 16 (position 43184267)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 40567717
GRCz11 16 40517749
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCAAAACGCTCAGTTTGGCATCAGAAAAGATGGGACACTGGTGTTTGG[G/A]TAAGCACGCAGCCCACAGTCTCTCTCTCTCTGCAGTCTTTCCCTCAGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36221
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126129 Essential Splice Site 399 586 8 11
Genomic Location (Zv9):
Chromosome 16 (position 43196523)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 40579973
GRCz11 16 40530005
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGAAGTGCCGTCAGACTTCTACGTTGAACTGTCTGTGTGTATGTTTGC[A/T]GTATGCACAGCAGGTTTGTATGGCGATGGCTGCAATCAGACATGCACATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link