Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:165534
- Ensembl ID:
- ENSDARG00000075149
- ZFIN ID:
- ZDB-GENE-070928-4
- Description:
- hypothetical protein LOC569719 [Source:RefSeq peptide;Acc:NP_001103185]
- Human Orthologue:
- NAGPA
- Human Description:
- N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase [Source:HGNC Symbol;Acc:17378]
- Mouse Orthologue:
- Nagpa
- Mouse Description:
- N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase Gene [Source:MGI Symbol;Acc:MGI:1
Alleles
There are 2 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa36220 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
| sa36221 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa36220
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000126129 | Essential Splice Site | 190 | 586 | 2 | 11 |
- Genomic Location (Zv9):
- Chromosome 16 (position 43184267)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 40567717 GRCz11 16 40517749 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATTCAAAACGCTCAGTTTGGCATCAGAAAAGATGGGACACTGGTGTTTGG[G/A]TAAGCACGCAGCCCACAGTCTCTCTCTCTCTGCAGTCTTTCCCTCAGGCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36221
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000126129 | Essential Splice Site | 399 | 586 | 8 | 11 |
- Genomic Location (Zv9):
- Chromosome 16 (position 43196523)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 40579973 GRCz11 16 40530005 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTGAAGTGCCGTCAGACTTCTACGTTGAACTGTCTGTGTGTATGTTTGC[A/T]GTATGCACAGCAGGTTTGTATGGCGATGGCTGCAATCAGACATGCACATG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
