zgc:111947

Ensembl ID:
ENSDARG00000075143
ZFIN ID:
ZDB-GENE-050522-94
Description:
hypothetical protein LOC553795 [Source:RefSeq peptide;Acc:NP_001018593]
Human Orthologue:
NANP
Human Description:
N-acetylneuraminic acid phosphatase [Source:HGNC Symbol;Acc:16140]
Mouse Orthologues:
Gm6741, Nanp
Mouse Descriptions:
N-acetylneuraminic acid phosphatase Gene [Source:MGI Symbol;Acc:MGI:1914561]
predicted gene 6741 Pseudogene [Source:MGI Symbol;Acc:MGI:3643504]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42281 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42281
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111139 Nonsense 176 242 2 2
ENSDART00000132808 Nonsense 177 243 2 2
Genomic Location (Zv9):
Chromosome 13 (position 42598517)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 41819566
GRCz11 13 41945536
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGATCATCCGGAGCAGAAGCCGGCGCGCTCCATCTTCACTCACTGCTTC[G/T]AGTCTGCAGGAGTTCGGCCGCAGGACTGCATCATGGTGGGAGATTCTCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link