si:dkey-265m8.2

Ensembl ID:
ENSDARG00000075129
ZFIN ID:
ZDB-GENE-040724-84
Description:
28S ribosomal protein S11, mitochondrial [Source:RefSeq peptide;Acc:NP_001038262]
Human Orthologue:
MRPS11
Human Description:
mitochondrial ribosomal protein S11 [Source:HGNC Symbol;Acc:14050]
Mouse Orthologue:
Mrps11
Mouse Description:
mitochondrial ribosomal protein S11 Gene [Source:MGI Symbol;Acc:MGI:1915244]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38597 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38597
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112980   None 199 None 6
ENSDART00000135446 Nonsense 240 240 6 6
Genomic Location (Zv9):
Chromosome 7 (position 15397734)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 14274902
GRCz11 7 14520365
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTGAAGAAGGTTGGGGAGTTGCGGAAGAAACTGAAAGTGAACAGCGGA[C/T]GAGGTAGGAGGCTGGTTGAGGACGGGGGATCGGTGAAATGAGGTGCCGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link