si:ch211-10e2.7

Ensembl ID:
ENSDARG00000075116
ZFIN IDs:
ZDB-GENE-030131-3169, ZDB-GENE-030829-32
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0R0I2]
Human Orthologue:
SALL2
Human Description:
sal-like 2 (Drosophila) [Source:HGNC Symbol;Acc:10526]
Mouse Orthologue:
Sall2
Mouse Description:
sal-like 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1354373]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45113 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45113
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108707 Nonsense 363 1128 1 2
ENSDART00000135307 Nonsense 498 1263 2 3
Genomic Location (Zv9):
Chromosome 2 (position 37855152)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38170066
GRCz11 2 38152394
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACGGTCACCTCTACCAATACAAACACTACTCAAAGGCATCAGAAACAG[C/T]AAGATGATGACCTGTGTGTTGACAGTCTGGAGGGTGCTACTGCATCAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link