zgc:193933

Ensembl ID:
ENSDARG00000075113
ZFIN ID:
ZDB-GENE-030131-5486
Description:
ovary-expressed homeobox protein [Source:RefSeq peptide;Acc:NP_001091862]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44104 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44104
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114762 Essential Splice Site 238 384 2 4
Genomic Location (Zv9):
Chromosome 24 (position 12740116)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 12691753
GRCz11 24 12838047
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGAGATGAAAACGCTTGCTGGAGCAACAGGATTAACATACAAGCAGG[T/A]GTGATTTTTATTTTTTAAACAAAAATAGGTTTATTTAGGTCTTTAATAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link