
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
dab2ip
- Ensembl ID:
- ENSDARG00000075110
- ZFIN ID:
- ZDB-GENE-030131-2449
- Description:
- DAB2 interacting protein [Source:RefSeq peptide;Acc:NP_001116329]
- Human Orthologue:
- DAB2IP
- Human Description:
- DAB2 interacting protein [Source:HGNC Symbol;Acc:17294]
- Mouse Orthologue:
- Dab2ip
- Mouse Description:
- disabled homolog 2 (Drosophila) interacting protein Gene [Source:MGI Symbol;Acc:MGI:1916851]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa40483 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa38484 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa40483
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110645 | Nonsense | 556 | 1061 | 8 | 13 |
ENSDART00000133504 | Nonsense | 604 | 1109 | 9 | 14 |
- Genomic Location (Zv9):
- Chromosome 5 (position 35312022)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 33093971 GRCz11 5 33694124 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAGATGAGCGTTCCTTCTGACCGAGTGCCCTCGCCACCAGTCCCTGGATG[C/A]AGCATCTCCACTGGAATACAAAAGATGGCCATTGACAGCGACCTGCCAGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa38484
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110645 | Essential Splice Site | 1006 | 1061 | 12 | 13 |
ENSDART00000133504 | Essential Splice Site | 1054 | 1109 | 13 | 14 |
- Genomic Location (Zv9):
- Chromosome 5 (position 35300741)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 33082690 GRCz11 5 33682843 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTGATATGCAGGCAGTTGTTGACTCCAAACAGAAGATCATTGATGCACAG[G/A]TACTGTATGTCTATAACAGCAGTCATGGAATCCAAACTATTTTGGGATTA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Abdominal aortic aneurysm: Genome-wide association study identifies a sequence variant within the DAB2IP gene conferring susceptibility to abdominal aortic aneurysm. (View Study)
- Periodontal microbiota: Genome-wide association study of periodontal pathogen colonization. (View Study)
- Thiazide-induced adverse metabolic effects in hypertensive patients: Genome-wide association analyses suggest NELL1 influences adverse metabolic response to HCTZ in African Americans. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: