
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
TMCO3
- Ensembl ID:
- ENSDARG00000075108
- Description:
- transmembrane and coiled-coil domains 3 [Source:HGNC Symbol;Acc:20329]
- Human Orthologue:
- TMCO3
- Human Description:
- transmembrane and coiled-coil domains 3 [Source:HGNC Symbol;Acc:20329]
- Mouse Orthologue:
- Tmco3
- Mouse Description:
- transmembrane and coiled-coil domains 3 Gene [Source:MGI Symbol;Acc:MGI:2444946]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa9562 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa9562
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109529 | Nonsense | 488 | 629 | 11 | 14 |
- Genomic Location (Zv9):
- Chromosome 1 (position 97435)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 227565 GRCz11 1 222744 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACGTGTCGATGGAGCTGGGTTGTTTTCTGGCCGGAGCGCTGCTGTCCTCT[C/T]AGGGTCACATGGTCACGGCAGAGGTCATGACCTGCGCTGAACCCATCCGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: