
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
NEO1 (2 of 2)
- Ensembl ID:
- ENSDARG00000075100
- Description:
- neogenin 1 [Source:HGNC Symbol;Acc:7754]
- Human Orthologue:
- NEO1
- Human Description:
- neogenin 1 [Source:HGNC Symbol;Acc:7754]
- Mouse Orthologue:
- Neo1
- Mouse Description:
- neogenin Gene [Source:MGI Symbol;Acc:MGI:1097159]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa9577 | Nonsense | Available for shipment | Available now |
sa44213 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa39468 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa9577
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000115280 | Nonsense | 359 | 1413 | 6 | 30 |
- Genomic Location (Zv9):
- Chromosome 25 (position 2898217)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 2805373 GRCz11 25 2931090 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGTGTGACGTCACCGGCTCTCCACCTCCGACTGTCAAGTGGATGAAGGAT[G/T]GAGACACGGTCATTCCTAGTGATTATTTCAGGATAGTGGTACGTCTGTGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa44213
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000115280 | Essential Splice Site | 800 | 1413 | 15 | 30 |
- Genomic Location (Zv9):
- Chromosome 25 (position 2946133)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 2854242 GRCz11 25 2980195 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACCGTCACTCTGGACTACAAGCAGCGCTTCTACAGCATTGATAACCTCGG[T/C]GAGCATCTGCACTGCCTTTAACCCTTTCACTCGTATGATCACTGAGGGAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39468
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000115280 | Nonsense | 1006 | 1413 | 20 | 30 |
- Genomic Location (Zv9):
- Chromosome 25 (position 2961029)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 25 2869239 GRCz11 25 2995092 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGTGGTGGAGCCGGTGGTGGGGAACCGACTGACCCATCAGATTCAGGGCT[T/A]GACTCTGGACACCAGCTACTTCTTCAAGATCCAGGCCAGAAACTCTAAAG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: