wu:fa96e12

Ensembl ID:
ENSDARG00000075083
ZFIN ID:
ZDB-GENE-030131-9008
Human Orthologue:
AC103686.1
Human Description:
DNA-dependent protein kinase catalytic subunit [Source:UniProtKB/Swiss-Prot;Acc:P78527]
Mouse Orthologue:
Prkdc
Mouse Description:
protein kinase, DNA activated, catalytic polypeptide Gene [Source:MGI Symbol;Acc:MGI:104779]

Alleles

There are 17 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40977 Essential Splice Site Mutation detected in F1 DNA During 2018
sa978 Essential Splice Site Available for shipment Available now
sa13311 Nonsense Available for shipment Available now
sa21046 Nonsense Available for shipment Available now
sa903 Essential Splice Site Available for shipment Available now
sa45289 Nonsense Mutation detected in F1 DNA During 2018
sa45288 Nonsense Mutation detected in F1 DNA During 2018
sa12418 Nonsense Available for shipment Available now
sa27016 Nonsense Mutation detected in F1 DNA During 2018
sa7082 Essential Splice Site Mutation detected in F1 DNA During 2018
sa17162 Nonsense Available for shipment Available now
sa13548 Essential Splice Site Available for shipment Available now
sa16262 Nonsense Available for shipment Available now
sa34148 Nonsense Available for shipment Available now
sa21045 Nonsense Available for shipment Available now
sa40976 Nonsense Mutation detected in F1 DNA During 2018
sa34147 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40977
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051679 Essential Splice Site 148 4119 4 86
ENSDART00000051679 Essential Splice Site 148 4119 4 86
Genomic Location (Zv9):
Chromosome 7 (position 44124381)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41114681
GRCz11 7 41394754
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGACAAATCTGCAAAGTGCAGAAATCCTGCTTTAGATCTTCTAATCAAA[G/A]TGAGTTCTTTTGTTTATATATTGTATGAATCTGACTCGAGACTTTGATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa978
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051679 Essential Splice Site 148 4119 4 86
ENSDART00000051679 Essential Splice Site 148 4119 4 86
Genomic Location (Zv9):
Chromosome 7 (position 44124381)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41114681
GRCz11 7 41394754
KASP Assay ID:
554-0883.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGACAAATCTGCAAAGTGCAGAAATCCTGCTTTAGATCTTCTAATCAAA[G/T]TGAGTTCTTTTGTTTATATATTGTATGAATCTGACTCGAGACTTTGATGT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa13311
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051679 Nonsense 1035 4119 27 86
Genomic Location (Zv9):
Chromosome 7 (position 44112872)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41103172
GRCz11 7 41383245
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCCGTAATKATGTACTTTTTKGWTACATAGGATGGGATTGTGGATCCAT[T/A]GGACAGCACCCTCAGAGACTTCAGTGGCACCTGCATCCAGGAATTTGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21046
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051679 Nonsense 1063 4119 27 86
Genomic Location (Zv9):
Chromosome 7 (position 44112789)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41103089
GRCz11 7 41383162
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATCCAGGAATTTGTCAAATGGTCTATCAAACAGACCACCCCCAAACAG[C/T]AGGAAAAGAGCCCGGCCAACATGAAATCCCTCTTCAAGCGTATCTACAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa903
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051679 Essential Splice Site 1136 4119 28 86
Genomic Location (Zv9):
Chromosome 7 (position 44112459)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41102759
GRCz11 7 41382832
KASP Assay ID:
554-0810.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTTTGTTGAGAGTTTGGCTTTGGCCCACTTTGATGAAAAGTCTGTGGG[T/G]AAGAAACTGGACCACTATCAAGATATCCTTTCAGATGGTTATGACCGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45289
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051679 Nonsense 1815 4119 41 86
Genomic Location (Zv9):
Chromosome 7 (position 44105935)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41096235
GRCz11 7 41376308
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGTCTTATTTGGGAAAACAAGTTCTTCTCCTCAGCTCCACCTACCAAT[C/A]ATTTCAAGCCAAAGAAGTTCCATCAAACTTCATGCTCATGGGTCTGATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45288
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051679 Nonsense 1950 4119 43 86
Genomic Location (Zv9):
Chromosome 7 (position 44104217)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41094517
GRCz11 7 41374590
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTCACGGAGAACATGACAGGAGAGATGGTACTGCTGGAGTTGAGGAGA[C/T]AGTTTCACTGCGCTGCTTACAACTGTGCCATAGCCCTTATCAGCTGCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12418
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051679 Nonsense 2015 4119 45 86
Genomic Location (Zv9):
Chromosome 7 (position 44103793)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41094093
GRCz11 7 41374166
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTGTCTTTAATTTTGTTAACAGGTCCCTATTGAGAGGAAAAAGAARTA[T/A]GTCATGATYAGGAAAGAAGTGAGTGGAGAAAACGGAGGTGAGTTGTCYGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27016
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051679 Nonsense 2316 4119 52 86
Genomic Location (Zv9):
Chromosome 7 (position 44099346)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41089646
GRCz11 7 41369719
KASP Assay ID:
2259-9326.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCACAATTTTTATGTTCCAGATATTTTCAGTCGCTGGCCAATAATCTAT[C/A]ATTCATCAGATATAAAGAGGTGTACTCAGCAGCTGCTGAGGTCATTGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7082
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051679 Essential Splice Site 2436 4119 55 86
Genomic Location (Zv9):
Chromosome 7 (position 44098669)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41088969
GRCz11 7 41369042
KASP Assay ID:
554-5129.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAATAGARAAACATTGTAGATGAGAAAATAAACACTYACTTGTCTTTCA[G/T]AGATGAGGGCAGACAGCGGGTTTGTCTGGACATTATTCATAAGATCCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17162
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051679 Nonsense 2804 4119 61 86
Genomic Location (Zv9):
Chromosome 7 (position 44092827)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41083127
GRCz11 7 41363200
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGATCTTCCTGATATTCAGATTCAGTTCAGCAGCCTCATTGCGCCACTA[C/T]AGGCCCTGGCACAGGTTWAATTCAGAGTTATTTTCAACACTGTGTGTGTW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13548
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051679 Essential Splice Site 3048 4119 65 86
Genomic Location (Zv9):
Chromosome 7 (position 44089879)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41080179
GRCz11 7 41360252
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGCTCCCCTATCAGACTAGACAGAATGTGGACAGAGACATTTTATGTG[G/A]TACTWATTCTAATTTTGAGCTATTTTGCWGTGGATTTATCACCATGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16262
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051679 Nonsense 3104 4119 66 86
Genomic Location (Zv9):
Chromosome 7 (position 44089538)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41079838
GRCz11 7 41359911
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATCATGGAGACTCACTACAGTCAAGAGCTSAGTCTGCTGTACATCCTC[C/T]AAGAAGACTATGACAGAGCTAAATACTACGCCAACAACTGCATGCAAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34148
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051679 Nonsense 3155 4119 67 86
Genomic Location (Zv9):
Chromosome 7 (position 44088477)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41078777
GRCz11 7 41358850
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCTGCAGTCTGTCCAAGCTCTGACCGAGATCCAAGACTTCTTGAATTA[T/A]ATCACAGGAGATGGTGGGTTTTTGTGCTCAGTGGAGTTGGATTAATGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21045
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051679 Nonsense 3389 4119 72 86
Genomic Location (Zv9):
Chromosome 7 (position 44086154)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41076454
GRCz11 7 41356527
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTGCAGATTCAGGCTCTGGAGTTGTTGAGGAGTGCTGCATGTAAAGCA[G/T]AAGAGGAAGAGCAGTCTTTCAGCCAACAGCATGTGAACACGCATGGTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40976
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051679 Nonsense 3409 4119 72 86
Genomic Location (Zv9):
Chromosome 7 (position 44086092)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41076392
GRCz11 7 41356465
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTCTTTCAGCCAACAGCATGTGAACACGCATGGTATTGTGGAAGCCTA[C/A]ATGACCATGGCCAACTTCTGTGACCGAAGACTACGAGAGAGTGAACAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34147
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051679 Nonsense 3845 4119 81 86
Genomic Location (Zv9):
Chromosome 7 (position 44081766)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 41072066
GRCz11 7 41352139
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTATGATGAGTGGATCAGTAAAGTTGCTGGAAAGGTGGAGGGCATTAGA[C/T]GATACGCTGAATTGTACAAGTAAGTCATTGTTTCATTTATTAAAAAAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link