si:dkey-222h21.14

Ensembl ID:
ENSDARG00000075055
ZFIN ID:
ZDB-GENE-090312-32
Description:
Novel protein similar to vertebrate gamma-glutamyltransferase family [Source:UniProtKB/TrEMBL;Acc:B8
Human Orthologues:
GGT1, GGT2, GGTLC1, GGTLC2, GGTLC3
Human Descriptions:
gamma-glutamyltransferase 1 [Source:HGNC Symbol;Acc:4250]
gamma-glutamyltransferase 2 [Source:HGNC Symbol;Acc:4251]
gamma-glutamyltransferase light chain 1 [Source:HGNC Symbol;Acc:16437]
gamma-glutamyltransferase light chain 2 [Source:HGNC Symbol;Acc:18596]
gamma-glutamyltransferase light chain 3 [Source:HGNC Symbol;Acc:33426]
Mouse Orthologue:
Ggt1
Mouse Description:
gamma-glutamyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:95706]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32803 Nonsense Available for shipment Available now
sa32804 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32803
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073779 Nonsense 588 646 14 15
ENSDART00000145234 Nonsense 500 523 12 12
Genomic Location (Zv9):
Chromosome 1 (position 59031649)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 57609597
GRCz11 1 58345279
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGACAGTAATGGGTTGGCTGTCGAGGAAGTATCATAATATTTCTCAGTA[T/A]ACTTCATTAACAATGGTCCAGGTGGTTGAAAAGGAAGGGAGCCAAGTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32804
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073779 Nonsense 590 646 14 15
ENSDART00000145234 Nonsense 502 523 12 12
Genomic Location (Zv9):
Chromosome 1 (position 59031654)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 57609602
GRCz11 1 58345284
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTAATGGGTTGGCTGTCGAGGAAGTATCATAATATTTCTCAGTATACTT[C/A]ATTAACAATGGTCCAGGTGGTTGAAAAGGAAGGGAGCCAAGTCTGTGCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link