SIPA1L2 (3 of 3)

Ensembl ID:
ENSDARG00000075052
Description:
signal-induced proliferation-associated 1 like 2 [Source:HGNC Symbol;Acc:23800]
Human Orthologue:
SIPA1L2
Human Description:
signal-induced proliferation-associated 1 like 2 [Source:HGNC Symbol;Acc:23800]
Mouse Orthologue:
Sipa1l2
Mouse Description:
signal-induced proliferation-associated 1 like 2 Gene [Source:MGI Symbol;Acc:MGI:2676970]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16220 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16220
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113275 Nonsense 32 511 1 8
Genomic Location (Zv9):
Chromosome 13 (position 49930586)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 48679956
GRCz11 13 48902604
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAACTTTGAGGGCATCGTGGCRGATGTGGAGCCGTTCGGGTACGCCTGG[A/T]AGGCTGGTCTGCGGCAGGGCAGTCGRCTAGTGGAGATCTGCAAGGTGGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link