zgc:172163

Ensembl ID:
ENSDARG00000075029
ZFIN ID:
ZDB-GENE-080402-6
Description:
hypothetical protein LOC100144556 [Source:RefSeq peptide;Acc:NP_001116524]
Human Orthologue:
ERAP2
Human Description:
endoplasmic reticulum aminopeptidase 2 [Source:HGNC Symbol;Acc:29499]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30866 Nonsense Mutation detected in F1 DNA During 2018
sa26582 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30866
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115372 Nonsense 139 935 1 18
Genomic Location (Zv9):
Chromosome 5 (position 56120079)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 51596349
GRCz11 5 52242942
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCATCTTCTCCCCAAAGATCCTCACTTCCGGGGAAAAATATTTCTTGTA[T/A]CTGGAGTTTGGCGCACCGTTGAGTGATGGCTTCCATGGCTTTTATAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26582
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115372 Essential Splice Site 350 935 6 18
Genomic Location (Zv9):
Chromosome 5 (position 56116919)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 51593189
GRCz11 5 52239782
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCAGTCCAGTGGTTTATAGTCCAGTAACATTAAAATTGATATCTCTCCA[G/A]TGGTTCGGGAACCTGGTGACGATGGATTGGTGGAATGACATATGGCTGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link