
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
grinl1a
- Ensembl ID:
- ENSDARG00000075017
- ZFIN ID:
- ZDB-GENE-041111-91
- Human Orthologues:
- AC090651.1, GCOM1
- Human Descriptions:
- GRINL1A complex locus protein 1 [Source:UniProtKB/Swiss-Prot;Acc:P0CAP1]
- GRINL1A complex locus [Source:HGNC Symbol;Acc:26424]
- Mouse Orthologues:
- Gcom1, RP23-357O18.3
- Mouse Description:
- GRINL1A complex locus Gene [Source:MGI Symbol;Acc:MGI:2142908]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa17153 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa17153
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110265 | Nonsense | 365 | 584 | 10 | 14 |
- Genomic Location (Zv9):
- Chromosome 7 (position 53849762)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 52119612 GRCz11 7 52394682 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GTGATTGTGAGCAACGCTTGCRTGGTTTGGATGAAACWGACCATGCAGAC[A/T]AAGCTGCGGCCAAACAGTAAGTAACATCTAATTTATGTTCTGAAAATATT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Coronary heart disease: Genome-wide association study of coronary heart disease and its risk factors in 8,090 African Americans: the NHLBI CARe Project. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: