si:dkeyp-88f5.1

Ensembl ID:
ENSDARG00000075016
ZFIN ID:
ZDB-GENE-070705-554
Description:
Novel protein similar to vertebrate apolipoprotein B (Including Ag(X) antigen) (APOB) [Source:UniPro
Human Orthologue:
APOB
Human Description:
apolipoprotein B (including Ag(x) antigen) [Source:HGNC Symbol;Acc:603]
Mouse Orthologue:
Apob
Mouse Description:
apolipoprotein B Gene [Source:MGI Symbol;Acc:MGI:88052]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37185 Nonsense Mutation detected in F1 DNA During 2018
sa23825 Nonsense Available for shipment Available now
sa17651 Nonsense Available for shipment Available now
sa43552 Nonsense Mutation detected in F1 DNA During 2018
sa6658 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37185
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113074 Nonsense 550 2476 10 19
ENSDART00000113553 Nonsense 689 962 13 17
ENSDART00000138336   None 1531 None 3
Genomic Location (Zv9):
Chromosome 20 (position 53800231)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 53645010
GRCz11 20 53450427
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATTCCACTCTCAGTCTTCTGTGTGCTTTAGGCGACTCAGAACATAGTC[A/T]AAGAAATCAGTGACAGTGTCAACAAGCTTTCTGAAGACTTAAAGGCCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23825
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113074 Nonsense 671 2476 12 19
ENSDART00000113553 Nonsense 810 962 15 17
ENSDART00000138336   None 1531 None 3
Genomic Location (Zv9):
Chromosome 20 (position 53801444)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 53646223
GRCz11 20 53451640
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACTACATGATTACAGGGGGACTTTGCGTTCATGCTGTCTGCTGGGGTT[G/T]AGTTGGTGACTGAGATTGGGACTCATTTACCCGACTATGTTCATTCTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17651
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113074 Nonsense 1170 2476 19 19
ENSDART00000113553   None 962 None 17
ENSDART00000138336 Nonsense 225 1531 3 3
Genomic Location (Zv9):
Chromosome 20 (position 53815931)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 53660710
GRCz11 20 53466127
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGTGMTGCTGGGCAAATTTCTGGAGATGGGARCCTGGAAGGATCCTTC[A/T]AGGCTGGTTCAATCTATGGATCAGGAAATCTAAAACAATCAGTTTTGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43552
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113074 Nonsense 1864 2476 19 19
ENSDART00000113553   None 962 None 17
ENSDART00000138336 Nonsense 919 1531 3 3
Genomic Location (Zv9):
Chromosome 20 (position 53818013)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 53662792
GRCz11 20 53468209
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCAGTGATTTTAAAAGTTCTGAATACAGGAATTGGCAAATTTACCCTT[G/T]AAGACTTCTCTGATGAAGGCACCCATGACAGTGATCTACTTTTTACCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6658
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113074 Nonsense 2363 2476 19 19
ENSDART00000113553   None 962 None 17
ENSDART00000138336 Nonsense 1418 1531 3 3
Genomic Location (Zv9):
Chromosome 20 (position 53819510)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 53664289
GRCz11 20 53469706
KASP Assay ID:
554-5058.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTYATTATTTGCTGGACATTGATTCAAACTACACACAYAAATATAGAAGA[G/T]AAGAAGTTGCAGTGAAACACACTGCTCWCGGTAAAACTACAATTATTCCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link