zgc:154070

Ensembl ID:
ENSDARG00000075007
ZFIN ID:
ZDB-GENE-060929-40
Description:
carbohydrate sulfotransferase 2 [Source:RefSeq peptide;Acc:NP_001073464]
Human Orthologue:
CHST2
Human Description:
carbohydrate (N-acetylglucosamine-6-O) sulfotransferase 2 [Source:HGNC Symbol;Acc:1970]
Mouse Orthologue:
Chst2
Mouse Description:
carbohydrate sulfotransferase 2 Gene [Source:MGI Symbol;Acc:MGI:1891160]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32841 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa32841
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111712 Nonsense 55 423 1 1
ENSDART00000138136 Nonsense 96 464 1 1
Genomic Location (Zv9):
Chromosome 2 (position 7897566)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 8315220
GRCz11 2 8113225
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCAGCCAATGCAGGGAGTGAACTTCCAAAGCAGATCAGACATCCGCTA[T/A]CTTTATAAAGCCCCGCAGGTCAAGAAAAGGCAGCTGGTGTATGTGTTGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link