zgc:175222

Ensembl ID:
ENSDARG00000074997
ZFIN ID:
ZDB-GENE-030131-4471
Description:
zgc:175222 (zgc:175222), mRNA [Source:RefSeq DNA;Acc:NM_001111159]
Human Orthologue:
TRIOBP
Human Description:
TRIO and F-actin binding protein [Source:HGNC Symbol;Acc:17009]
Mouse Orthologue:
Triobp
Mouse Description:
TRIO and F-actin binding protein Gene [Source:MGI Symbol;Acc:MGI:1349410]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35174 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35174
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113200 Nonsense 418 637 10 15
Genomic Location (Zv9):
Chromosome 12 (position 529852)
Other Location(s):
Assembly Chromosome Position
GRCz11 12 517978
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTGTGTGTGTGTGTGTGTGTGTGTGTAAGGGAGGAGCTGGTGTCGTA[T/A]CAGCGGGAGATCGAGGTGCTGTCAGAGCAGTATTCACAGAAGTGTCTGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link