zgc:171428

Ensembl ID:
ENSDARG00000074996
ZFIN ID:
ZDB-GENE-080220-62
Description:
hypothetical protein LOC573117 [Source:RefSeq peptide;Acc:NP_001107918]
Human Orthologue:
TBRG1
Human Description:
transforming growth factor beta regulator 1 [Source:HGNC Symbol;Acc:29551]
Mouse Orthologue:
Tbrg1
Mouse Description:
transforming growth factor beta regulated gene 1 Gene [Source:MGI Symbol;Acc:MGI:1100877]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39206 Essential Splice Site Mutation detected in F1 DNA During 2018
sa14194 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39206
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129624 Essential Splice Site 58 537 2 14
Genomic Location (Zv9):
Chromosome 18 (position 33575041)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35256225
GRCz11 18 35231071
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCGAGGTTGCAGATAAACCAAACCTCACATGGCTCGATGCTGCTCAGG[T/A]AAAAATAATCTTTTTTTTTTAAATTATGTTGTGGTTAATTGACACCAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14194
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129624 Nonsense 295 537 9 14
Genomic Location (Zv9):
Chromosome 18 (position 33582098)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35263282
GRCz11 18 35238128
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTATTTTGARATTGCATATGTTTGTTTGCTTTAYTTWCAGTCATGAGG[A/T]RGATTTGTAAGAAGAGGAAGGTAGCTGAGGGAGGWGCACGCAAGCKCGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link