sparcl1

Ensembl ID:
ENSDARG00000074989
ZFIN ID:
ZDB-GENE-060130-6
Description:
SPARC-like protein 1 [Source:RefSeq peptide;Acc:NP_001124077]
Human Orthologue:
SPARCL1
Human Description:
SPARC-like 1 (hevin) [Source:HGNC Symbol;Acc:11220]
Mouse Orthologue:
Sparcl1
Mouse Description:
SPARC-like 1 Gene [Source:MGI Symbol;Acc:MGI:108110]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1976 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa1976
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083593 Essential Splice Site 18 606 2 11
Genomic Location (Zv9):
Chromosome 1 (position 37242512)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 36694403
GRCz11 1 37392064
KASP Assay ID:
554-2711.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAGAGGTGTTTCTCTTCTGCTTTTTGGTAACAGCRCTGGCTGCATATG[T/C]AAGTACAATACCCAAACTTCCGCAACATTTCTATKATCATGCACAATAGA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link