zgc:172290

Ensembl ID:
ENSDARG00000074983
ZFIN IDs:
ZDB-GENE-060130-8, ZDB-GENE-080218-23
Description:
hypothetical protein LOC796074 [Source:RefSeq peptide;Acc:NP_001107106]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa26882 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa26882
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111896 Nonsense 39 315 2 2
Genomic Location (Zv9):
Chromosome 7 (position 9321790)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 8269155
GRCz11 7 8515113
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAAAAAATGGTGCCAGTTTGCAGAGGATCTGGGTTTGGGTTGGAGGAT[G/A]GCAGATCAAGGGTGTCAGGGCCTGGCTTACAGATGGAAGAGAAAAATCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link