zgc:171845

Ensembl ID:
ENSDARG00000074976
ZFIN ID:
ZDB-GENE-080516-7
Description:
hypothetical protein LOC100151759 [Source:RefSeq peptide;Acc:NP_001120946]
Human Orthologue:
DCLK1
Human Description:
doublecortin-like kinase 1 [Source:HGNC Symbol;Acc:2700]
Mouse Orthologue:
Dclk1
Mouse Description:
doublecortin-like kinase 1 Gene [Source:MGI Symbol;Acc:MGI:1330861]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42590 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42590
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102451   None 194 None 5
ENSDART00000122507 Essential Splice Site 242 752 3 15
Genomic Location (Zv9):
Chromosome 15 (position 33019981)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 32996570
GRCz11 15 32854549
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCAGATGGGTGTAAGACTAATCCTGTACATCTCTCTTCTGTATTTATA[G/A]GTGACCTGCCTTCAGGACTTCTTTGGAGAAGATGATATATTTATTGCCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link