sb:cb730

Ensembl ID:
ENSDARG00000074927
ZFIN ID:
ZDB-GENE-030829-51
Human Orthologue:
BUB1B
Human Description:
budding uninhibited by benzimidazoles 1 homolog beta (yeast) [Source:HGNC Symbol;Acc:1149]
Mouse Orthologue:
Bub1b
Mouse Description:
budding uninhibited by benzimidazoles 1 homolog, beta (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MG

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42842 Nonsense Mutation detected in F1 DNA During 2018
sa19158 Nonsense Mutation detected in F1 DNA During 2018
sa25034 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42842
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110529 Nonsense 108 427 3 9
Genomic Location (Zv9):
Chromosome 17 (position 1513033)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 1955982
GRCz11 17 2132795
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGGTCATGCGCTTTACAGCTGAGCAGAAATATCACAATGATGTCCGCTA[T/A]GTTGAACTCTGGATCCAGTTTGTGAGTGACTGACCTTAAAAGATTAGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19158
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110529 Nonsense 186 427 5 9
Genomic Location (Zv9):
Chromosome 17 (position 1516112)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 1959061
GRCz11 17 2135874
KASP Assay ID:
2261-0475.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACCGCGTCTTATATTTGAAGTGGTTTTGTCTCCAGAGCTCTGCAGGCG[C/T]GAGTGTGTAGACAGATGATGACATCCATGACTGAACAACACAGAAATGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25034
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110529 Nonsense 287 427 6 9
Genomic Location (Zv9):
Chromosome 17 (position 1522508)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 1965457
GRCz11 17 2142270
KASP Assay ID:
554-7800.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGCCCAGATTTGAGGTCTGGACGGCGCCGCCTGCTGCCCGAGCCAAA[G/T]AGAACCAGCAGAAAGTGGAGAAGTGGAGCAACGTGAAGGTGATCATTCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link