wu:fb99g09

Ensembl ID:
ENSDARG00000074910
ZFIN ID:
ZDB-GENE-030131-2214
Human Orthologue:
CRTC2
Human Description:
CREB regulated transcription coactivator 2 [Source:HGNC Symbol;Acc:27301]
Mouse Orthologue:
Crtc2
Mouse Description:
CREB regulated transcription coactivator 2 Gene [Source:MGI Symbol;Acc:MGI:1921593]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36901 Nonsense Mutation detected in F1 DNA During 2018
sa36902 Nonsense Mutation detected in F1 DNA During 2018
sa6567 Nonsense Mutation detected in F1 DNA During 2018
sa23585 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa36901
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115123 Nonsense 42 759 1 14
Genomic Location (Zv9):
Chromosome 19 (position 42493128)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 41936142
GRCz11 19 41521197
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGCAATCCGCGCAAATTCAGCGAGAAAATCGCCCTGCACAACCAGCGA[C/T]AGGCTGAAGAAACCGCAGCTTTTCGAGAGGTTATGATGGACATTAATTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36902
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115123 Nonsense 515 759 11 14
Genomic Location (Zv9):
Chromosome 19 (position 42505700)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 41948714
GRCz11 19 41533769
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACAGTATCAGTCTATCCCAGAGCTGGAGCAGTGGATTCACAACGAACAT[C/T]AGCAAACACACAATCAGAGACAAAAACACAGCCCAGTTCACAAACACCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6567
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115123 Nonsense 582 759 11 14
Genomic Location (Zv9):
Chromosome 19 (position 42505901)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 41948915
GRCz11 19 41533970
KASP Assay ID:
554-4661.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCAAGAGCAGCAGAATCAGTGGCATCAGCAGAACCAGTATCAAAATCAA[C/T]AGCTTCATCAAAACACWGCGWTCCAGTGTCCTGATCAAGAGCAAAACTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23585
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115123 Essential Splice Site 679 759 12 14
Genomic Location (Zv9):
Chromosome 19 (position 42509207)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 41952221
GRCz11 19 41537276
KASP Assay ID:
2261-3642.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTCGGCTTACATCTGACCCCTAGCCAGGCAAAAGCCCTTTCCCAGCAG[G/A]TACGTTGTTTATTACATAAATCATCAGTTATGATTACACACCTATACACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link