
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
col6a1
- Ensembl ID:
- ENSDARG00000074908
- ZFIN ID:
- ZDB-GENE-070501-6
- Human Orthologue:
- COL6A1
- Human Description:
- collagen, type VI, alpha 1 [Source:HGNC Symbol;Acc:2211]
- Mouse Orthologue:
- Col6a1
- Mouse Description:
- collagen, type VI, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88459]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa949 | Nonsense | F2 line generated | During 2018 |
sa21945 | Essential Splice Site | Available for shipment | Available now |
sa31842 | Essential Splice Site | Available for shipment | Available now |
sa21944 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa949
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110608 | Nonsense | 211 | 1010 | 7 | 38 |
- Genomic Location (Zv9):
- Chromosome 11 (position 34896002)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 33796939 GRCz11 11 34059741 - KASP Assay ID:
- 554-0854.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTTCCCAGGACACCAGACTGTCTGTCATTGCCACAGATATAAACTACAGA[C/T]AGAACTTCACCGCTGCAGACAACTCCCGCTCCACACAAATGAGCACTATA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21945
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110608 | Essential Splice Site | 368 | 1010 | 17 | 38 |
- Genomic Location (Zv9):
- Chromosome 11 (position 34884907)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 33785844 GRCz11 11 34048646 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AATCAGGGCCTAAAGGAGACCCCGGACAATATGGACGCAAAGGAGAACGA[G/A]TAAGAGATGAGAACGAGTCTGTGTTTGAGTAAAATGTGCATTTGGATATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa31842
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110608 | Essential Splice Site | 520 | 1010 | 25 | 38 |
- Genomic Location (Zv9):
- Chromosome 11 (position 34865745)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 33766682 GRCz11 11 34029484 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTGAAGACGGACCTCCAGGAAACGGGACGGAGGGTTGTGCTGGCTTTCAG[G/C]TACAGCAAATTTCTGTTGATTAAATGTTTTGCCAATTAAAGTCATATTTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21944
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110608 | Essential Splice Site | 814 | 1010 | 38 | 38 |
- Genomic Location (Zv9):
- Chromosome 11 (position 34835832)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 33736769 GRCz11 11 33999571 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTCAGCATTTTGACTTCGAGATATTAATGGTTTGCTTCTTCCTCTTCTTC[A/G]GTTTCATTTAATGACAACACCGATGTCCTCATCATGATGGACAGCTCGGC
- Associated Phenotype:
- Not determined
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: