zgc:195317

Ensembl ID:
ENSDARG00000074906
ZFIN ID:
ZDB-GENE-081022-210
Description:
hypothetical protein LOC100189616 [Source:RefSeq peptide;Acc:NP_001128615]
Human Orthologue:
ZNF831
Human Description:
zinc finger protein 831 [Source:HGNC Symbol;Acc:16167]
Mouse Orthologue:
Zfp831
Mouse Description:
zinc finger protein 831 Gene [Source:MGI Symbol;Acc:MGI:3641861]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7353 Missense Mutation detected in F1 DNA During 2018
sa8559 Nonsense Mutation detected in F1 DNA During 2018
sa14446 Nonsense Available for shipment Available now
sa14603 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7353
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122253 Missense 30 1580 1 3
Genomic Location (Zv9):
Chromosome 11 (position 411684)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 398421
GRCz11 11 424919
KASP Assay ID:
554-4023.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCTCAGTGTTCAGAGTCTGCACAGAGAGAGGAAGAGGCGCATGTTCAG[G/A]CCCGTCTCACCRCTATGTATGTCCAGAACGTTCCTGCTTCTGGCCTGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8559
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122253 Nonsense 538 1580 1 3
Genomic Location (Zv9):
Chromosome 11 (position 410160)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 396897
GRCz11 11 423395
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTAGTCAGACAGGTGGCAGTGGATTGCCTGTRTAGTGCCGAGGCAGAA[A/T]GAGGCAGCATGAGCAGCCTGAGCTCAGACGGAGACAGCACCGATGTCGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14446
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122253 Nonsense 1086 1580 1 3
Genomic Location (Zv9):
Chromosome 11 (position 408516)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 395253
GRCz11 11 421751
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAYAAAGTTTCACATCTCGGCCTCAGYGGACTATCSTAAAAACACAACA[C/T]AMCCGCTGGAGTTACCAGAGCTGAWGAACTCTGGAAGTCTTSAGGTTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14603
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122253 Nonsense 1317 1580 2 3
Genomic Location (Zv9):
Chromosome 11 (position 399906)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 386643
GRCz11 11 413141
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGATGGYGTTMGGAAAAACCTGAGGTTTCAGAGGGACTCAAGGACAGAT[A/T]GAAGGGAATCARGAGCCAAAATACGGGAAGATGGAGATGAAGAGGGGAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link