zgc:172284

Ensembl ID:
ENSDARG00000074905
ZFIN ID:
ZDB-GENE-080402-7
Description:
calcium/calmodulin-dependent protein kinase type 1D [Source:RefSeq peptide;Acc:NP_001116532]
Human Orthologue:
CAMK1D
Human Description:
calcium/calmodulin-dependent protein kinase ID [Source:HGNC Symbol;Acc:19341]
Mouse Orthologue:
Camk1d
Mouse Description:
calcium/calmodulin-dependent protein kinase ID Gene [Source:MGI Symbol;Acc:MGI:2442190]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31375 Nonsense Available for shipment Available now
sa16156 Essential Splice Site Available for shipment Available now
sa20203 Nonsense Available for shipment Available now
sa6928 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa31375
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104676 Nonsense 55 433 2 11
Genomic Location (Zv9):
Chromosome 4 (position 7124155)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 7935374
GRCz11 4 7944003
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGTCCTGGCGGAGGAGCGGTCCACGGGAAAGATGTACGCTGTGAAATG[C/A]ATCCCTAAAAAAGCTCTGAAGGGGAAGGAGAGCAGCATCGAGAATGAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16156
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104676 Essential Splice Site 77 433 2 11
Genomic Location (Zv9):
Chromosome 4 (position 7124221)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 7935440
GRCz11 4 7944069
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGAAGGGGAAGGAGAGCAGCATCGAGAAYGAGATCGCCSTTCTGCGCAA[G/A]TGAGCTCCTTTGCCCACACCTCACACCTGTACCCATGGCAACAGCATCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20203
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104676 Nonsense 90 433 3 11
Genomic Location (Zv9):
Chromosome 4 (position 7130515)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 7941734
GRCz11 4 7950363
KASP Assay ID:
2259-4495.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTTTACAGAATTAAGCATGAGAACATAGTGGCTCTTGAAGACATCTA[C/A]GAAAGCTCAGATCACCTCTACCTTATAATGCAGCTGTGAGTATGTTCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6928
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104676 Essential Splice Site 149 433 5 11
Genomic Location (Zv9):
Chromosome 4 (position 7139436)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 7950655
GRCz11 4 7959284
KASP Assay ID:
554-5143.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACACACAGTTTTCCCACTAGCTTCATTTTAACGTGTGTTTTTCACTCC[A/T]GCCTGAGAATCTGCTCTACTTCAACCCTCAAGACGGCTCAAAAATCATGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link