si:dkey-228b2.5

Ensembl ID:
ENSDARG00000074894
ZFIN ID:
ZDB-GENE-091113-62
Human Orthologue:
KIAA1161
Human Description:
KIAA1161 [Source:HGNC Symbol;Acc:19918]
Mouse Orthologue:
AI464131
Mouse Description:
expressed sequence AI464131 Gene [Source:MGI Symbol;Acc:MGI:2140300]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23877 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23877
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114326 Nonsense 359 685 2 2
ENSDART00000133517 Nonsense 359 685 3 3
Genomic Location (Zv9):
Chromosome 21 (position 11251943)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 12953308
GRCz11 21 13050296
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGCCATGTTTCAAAAGCTCAAGGCAGATGGAATCCTGGTATCTCTGT[G/A]GACACATCCCTTTGTGAATTATGATTCAGCTAATTTTGGGCATTGTGTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link