si:dkey-4c15.16

Ensembl ID:
ENSDARG00000074868
ZFIN IDs:
ZDB-GENE-050420-215, ZDB-GENE-080722-17, ZDB-GENE-080722-17
Description:
hypothetical protein LOC100170822 [Source:RefSeq peptide;Acc:NP_001124129]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24052 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24052
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106374   None 507 None 4
ENSDART00000106606 Essential Splice Site 18 507 1 4
ENSDART00000147644 Essential Splice Site 18 62 2 4
ENSDART00000148300 Essential Splice Site 18 147 2 4
Genomic Location (Zv9):
Chromosome 22 (position 1549884)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2290974
GRCz11 22 2307240
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATCCAGAACCCTGCAGAATTAAACAGGAGGAGACTGAAGAACTAATAG[G/A]TTTGTGTTTATCATTTACTTCACAGATATCTACAGCTGTTTAGTGTAGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link