si:dkey-24h22.4

Ensembl ID:
ENSDARG00000074860
ZFIN ID:
ZDB-GENE-090313-273
Description:
Novel protein similar to H.sapiens SLC5A7, solute carrier family 5 (Choline transporter), member 7 (
Human Orthologue:
SLC5A7
Human Description:
solute carrier family 5 (choline transporter), member 7 [Source:HGNC Symbol;Acc:14025]
Mouse Orthologue:
Slc5a7
Mouse Description:
solute carrier family 5 (choline transporter), member 7 Gene [Source:MGI Symbol;Acc:MGI:1927126]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6594 Nonsense Confirmed mutation in F2 line During 2018
sa39640 Nonsense Mutation detected in F1 DNA During 2018
sa38275 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6594
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114975 Nonsense 78 595 2 9
ENSDART00000147201 Nonsense 78 584 2 8
Genomic Location (Zv9):
Chromosome 1 (position 33877720)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 33512471
GRCz11 1 34245039
KASP Assay ID:
554-4562.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAACGTGGGTTGGTGGAGGKTACATCAAYGGTACAGCAGAATATGTATA[T/A]CTGCCCGGGTTCGGCTTGGCGTGGGCACAGGCTCYCTTCGGATATGCGCT
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Stage Entity Entity Quality Tag
Hatching:Long-pec
ZFS:0000033
locomotion
GO:0040011

circling
PATO:0001911
abnormal
PATO:0000460
Hatching:Long-pec
ZFS:0000033
thigmotaxis
GO:0001966

decreased intensity
PATO:0001783
abnormal
PATO:0000460
Hatching:Long-pec
ZFS:0000033
trunk
ZFA:0001115

decreased thickness
PATO:0000592
abnormal
PATO:0000460
Hatching:Long-pec
ZFS:0000033
whole organism
ZFA:0001094
anterior/posterior axis
BSPO:0000013
increased length
PATO:0000573
abnormal
PATO:0000460

Mutation Details

Allele Name:
sa39640
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114975 Nonsense 93 595 2 9
ENSDART00000147201 Nonsense 93 584 2 8
Genomic Location (Zv9):
Chromosome 1 (position 33877765)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 33512516
GRCz11 1 34245084
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATATCTGCCCGGGTTCGGCTTGGCGTGGGCACAGGCTCCCTTCGGATA[T/A]GCGCTTAGCCTTGTTTTGGGTATGTTGCGCATCTACGGCAGCTTTGATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38275
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114975 Essential Splice Site 303 595 6 9
ENSDART00000147201 Essential Splice Site 302 584 6 8
Genomic Location (Zv9):
Chromosome 1 (position 33886425)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 33521176
GRCz11 1 34253744
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCATGGCTATTCCCTCTGTCCTGATTGGAGCCATAGGGGCTTCCACAG[G/A]TAAAACAGAACCAGAATACTTCTTCTTCTCTTTTTCATCTATCTATCTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link