wu:fd60h05

Ensembl ID:
ENSDARG00000074852
ZFIN ID:
ZDB-GENE-030131-4797
Human Orthologue:
MYO15B
Human Description:
myosin XVB pseudogene [Source:HGNC Symbol;Acc:14083]
Mouse Orthologues:
Myo15b, Myo3b
Mouse Descriptions:
myosin IIIB Gene [Source:MGI Symbol;Acc:MGI:2448580]
myosin XVB Gene [Source:MGI Symbol;Acc:MGI:2685534]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22145 Nonsense Available for shipment Available now
sa42073 Essential Splice Site Mutation detected in F1 DNA During 2018
sa35342 Nonsense Mutation detected in F1 DNA During 2018
sa44769 Nonsense Mutation detected in F1 DNA During 2018
sa35341 Nonsense Available for shipment Available now
sa45469 Essential Splice Site Mutation detected in F1 DNA During 2018
sa45468 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa22145
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111897 Nonsense 65 1612 4 41
Genomic Location (Zv9):
Chromosome 12 (position 35195988)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 33600097
GRCz11 12 33701080
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCCCATTTGTTAAATCAGTTATTTGGTGTTTTGTTGATTAGGATGGAT[G/A]GTGCCAAGCACAGGGTTATCCACTTCAGAGGCCTTTGACGTCCCTTGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42073
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111897 Essential Splice Site 691 1612 18 41
Genomic Location (Zv9):
Chromosome 12 (position 35179132)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 33583241
GRCz11 12 33684224
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAGGCACTAGCCATTCTCAAATCTCAGGGCCCTGTCAGTCATCAGAAG[G/A]TAGACGATATTGAACCAAATGAGATGTCATAATGTAGTGCTTTAATTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35342
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111897 Nonsense 982 1612 26 41
Genomic Location (Zv9):
Chromosome 12 (position 35174105)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 33578214
GRCz11 12 33679197
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCATTTCCATTTGCAGAACTCAGAGTATGTGATCGCAGTGAAAAGCTA[T/A]GTAACAGATGACAAGAGCTTGCTGAGCTTCCACAGAGGTGACGCCATTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44769
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111897 Nonsense 1451 1612 38 41
Genomic Location (Zv9):
Chromosome 12 (position 35161586)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 33565695
GRCz11 12 33666678
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCCCATCTGACACTCTTATTTCTAAACCCGGCCAGTGCTGAGATAAAG[C/T]AGTATCATCCCCGGATGGATGGACTCAACTCTACTGATGAAAGACTCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35341
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111897 Nonsense 1471 1612 38 41
Genomic Location (Zv9):
Chromosome 12 (position 35161526)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 33565635
GRCz11 12 33666618
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCGGATGGATGGACTCAACTCTACTGATGAAAGACTCCTTGCTACGATA[C/T]GAGCGCAGTTTTCAACCTTAGGCCCCATCAGCCCTCTTGATGCCAAAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45469
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111897 Essential Splice Site 1535 1612 39 41
Genomic Location (Zv9):
Chromosome 12 (position 35159153)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 33563262
GRCz11 12 33664245
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTCGCAGTCAATCATGAAGTCATAACCGTCCTCGATCCTAAAACACTGG[T/G]ACGCCACACTTCATCTCACAGTCCAACATGTTTCCTGTGATGTTCTGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45468
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111897 Nonsense 1547 1612 40 41
Genomic Location (Zv9):
Chromosome 12 (position 35159043)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 33563152
GRCz11 12 33664135
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCACAATCTTTGCAGAATGCGTGTTTGACGATGTCCATGGAGGATGTGT[T/A]GTCCTTGCGCTCAATCCGTCCCAAAAAAGACAAGCTGCCATCAGTTGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link