wu:fd60h05
- Ensembl ID:
- ENSDARG00000074852
- ZFIN ID:
- ZDB-GENE-030131-4797
- Human Orthologue:
- MYO15B
- Human Description:
- myosin XVB pseudogene [Source:HGNC Symbol;Acc:14083]
- Mouse Orthologues:
- Myo15b, Myo3b
- Mouse Descriptions:
- myosin IIIB Gene [Source:MGI Symbol;Acc:MGI:2448580]
- myosin XVB Gene [Source:MGI Symbol;Acc:MGI:2685534]
Alleles
There are 7 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa22145 |
Nonsense |
Available for shipment |
Available now |
sa42073 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa35342 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa44769 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa35341 |
Nonsense |
Available for shipment |
Available now |
sa45469 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa45468 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
Mutation Details
- Allele Name:
- sa22145
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000111897 |
Nonsense |
65 |
1612 |
4 |
41 |
- Genomic Location (Zv9):
- Chromosome 12 (position 35195988)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
12 |
33600097 |
GRCz11 |
12 |
33701080 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAGCCCATTTGTTAAATCAGTTATTTGGTGTTTTGTTGATTAGGATGGAT[G/A]GTGCCAAGCACAGGGTTATCCACTTCAGAGGCCTTTGACGTCCCTTGACC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42073
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000111897 |
Essential Splice Site |
691 |
1612 |
18 |
41 |
- Genomic Location (Zv9):
- Chromosome 12 (position 35179132)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
12 |
33583241 |
GRCz11 |
12 |
33684224 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATGAGGCACTAGCCATTCTCAAATCTCAGGGCCCTGTCAGTCATCAGAAG[G/A]TAGACGATATTGAACCAAATGAGATGTCATAATGTAGTGCTTTAATTGAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35342
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000111897 |
Nonsense |
982 |
1612 |
26 |
41 |
- Genomic Location (Zv9):
- Chromosome 12 (position 35174105)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
12 |
33578214 |
GRCz11 |
12 |
33679197 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTCATTTCCATTTGCAGAACTCAGAGTATGTGATCGCAGTGAAAAGCTA[T/A]GTAACAGATGACAAGAGCTTGCTGAGCTTCCACAGAGGTGACGCCATTAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa44769
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000111897 |
Nonsense |
1451 |
1612 |
38 |
41 |
- Genomic Location (Zv9):
- Chromosome 12 (position 35161586)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
12 |
33565695 |
GRCz11 |
12 |
33666678 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTCCCCATCTGACACTCTTATTTCTAAACCCGGCCAGTGCTGAGATAAAG[C/T]AGTATCATCCCCGGATGGATGGACTCAACTCTACTGATGAAAGACTCCTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35341
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000111897 |
Nonsense |
1471 |
1612 |
38 |
41 |
- Genomic Location (Zv9):
- Chromosome 12 (position 35161526)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
12 |
33565635 |
GRCz11 |
12 |
33666618 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCCGGATGGATGGACTCAACTCTACTGATGAAAGACTCCTTGCTACGATA[C/T]GAGCGCAGTTTTCAACCTTAGGCCCCATCAGCCCTCTTGATGCCAAAGCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa45469
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000111897 |
Essential Splice Site |
1535 |
1612 |
39 |
41 |
- Genomic Location (Zv9):
- Chromosome 12 (position 35159153)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
12 |
33563262 |
GRCz11 |
12 |
33664245 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGTCGCAGTCAATCATGAAGTCATAACCGTCCTCGATCCTAAAACACTGG[T/G]ACGCCACACTTCATCTCACAGTCCAACATGTTTCCTGTGATGTTCTGATA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa45468
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000111897 |
Nonsense |
1547 |
1612 |
40 |
41 |
- Genomic Location (Zv9):
- Chromosome 12 (position 35159043)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
12 |
33563152 |
GRCz11 |
12 |
33664135 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATCACAATCTTTGCAGAATGCGTGTTTGACGATGTCCATGGAGGATGTGT[T/A]GTCCTTGCGCTCAATCCGTCCCAAAAAAGACAAGCTGCCATCAGTTGAGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: