
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
grap2b
- Ensembl ID:
- ENSDARG00000074837
- ZFIN ID:
- ZDB-GENE-040426-1485
- Description:
- GRB2-related adaptor protein 2b [Source:RefSeq peptide;Acc:NP_956972]
- Human Orthologues:
- GRAP2, NCK2
- Human Descriptions:
- GRB2-related adaptor protein 2 [Source:HGNC Symbol;Acc:4563]
- NCK adaptor protein 2 [Source:HGNC Symbol;Acc:7665]
- Mouse Orthologue:
- Grap2
- Mouse Description:
- GRB2-related adaptor protein 2 Gene [Source:MGI Symbol;Acc:MGI:1333842]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa31495 | Essential Splice Site | Available for shipment | Available now |
sa14352 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa31495
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110189 | Essential Splice Site | 27 | 249 | 3 | 8 |
- Genomic Location (Zv9):
- Chromosome 6 (position 568294)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 410582 GRCz11 6 433289 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTGACAACATCATGTATTTGGTCTGAGCTTAATTACCTTGTGCTCTTGT[A/T]GATTTTAGGCACCAATGACGACTGGTTCAGAGCTGAAATAAACGGTATGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14352
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000110189 | Nonsense | 231 | 249 | 8 | 8 |
- Genomic Location (Zv9):
- Chromosome 6 (position 572721)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 406155 GRCz11 6 428862 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGGCCGGAGACGTGATCGAGGTTYTGGATCAGTCCGATCGATCCTGGTGG[A/T]AAGGMGTCCTGCGTGGCAGAACTGGACTSTTCCCCGTCAACTACACCAAT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Addiction: NCK2 is significantly associated with opiates addiction in African-origin men. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: