LOC100151130

Ensembl ID:
ENSDARG00000074829
Human Orthologue:
RASIP1
Human Description:
Ras interacting protein 1 [Source:HGNC Symbol;Acc:24716]
Mouse Orthologue:
Rasip1
Mouse Description:
Ras interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1917153]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44840 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44840
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114411 Nonsense 115 989 2 15
Genomic Location (Zv9):
Chromosome 16 (position 14275578)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 12634233
GRCz11 16 12525135
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTCTGAGGGGCCGGTCCAATAGCGACAGGGACCGGGCCATTGGAGAA[C/T]GAGAAAGGGAGATATGGGCGCATTCAGCCACCCCTTCATCCCATCACTAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link