
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch73-184c24.1
- Ensembl ID:
- ENSDARG00000074827
- ZFIN ID:
- ZDB-GENE-100922-80
- Human Orthologue:
- C1orf116
- Human Description:
- chromosome 1 open reading frame 116 [Source:HGNC Symbol;Acc:28667]
- Mouse Orthologue:
- AA986860
- Mouse Description:
- expressed sequence AA986860 Gene [Source:MGI Symbol;Acc:MGI:2138143]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa37784 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa44047 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa44046 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa37784
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109982 | Nonsense | 60 | 464 | 2 | 7 |
ENSDART00000146808 | Nonsense | 65 | 130 | 3 | 4 |
- Genomic Location (Zv9):
- Chromosome 23 (position 41901314)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 41735439 GRCz11 23 41630864 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCCTGCTTGATGTTTCTGGAGGAGACCATTGAGTCTTTGGAGGCAGAATA[T/A]GACAGCGGTTTGTCAAACGATGAGCCTGATTGTCCATCCAATGGCCTGAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa44047
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109982 | None | 464 | None | 7 | |
ENSDART00000146808 | Nonsense | 95 | 130 | 3 | 4 |
- Genomic Location (Zv9):
- Chromosome 23 (position 41901226)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 41735351 GRCz11 23 41630776 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCAATGGCCTGAAAGAAAACATTGCTCATCCGACCTCCATCAGTCAGAAC[A/T]AATCTCAGGGTAAACACCAACACCAGAAACATCTACGGCAGTGGTTTTCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa44046
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109982 | Essential Splice Site | 99 | 464 | None | 7 |
ENSDART00000146808 | Essential Splice Site | 98 | 130 | None | 4 |
- Genomic Location (Zv9):
- Chromosome 23 (position 41900052)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 41734177 GRCz11 23 41629602 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGAGAGATAGCTTGGGATGTTTCAATAATAGCCTATAAATGTTCTCTTTC[A/T]GAGTTCTCTACCCTCGAAGGTCAAGTCAAAGTGATTGGAAAAGATGGTAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: