zgc:171422

Ensembl ID:
ENSDARG00000074825
ZFIN ID:
ZDB-GENE-080204-95
Description:
hypothetical protein LOC100001353 [Source:RefSeq peptide;Acc:NP_001107944]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39522 Nonsense Mutation detected in F1 DNA During 2018
sa30446 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39522
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113848 Nonsense 66 717 2 9
Genomic Location (Zv9):
Chromosome Zv9_NA915 (position 91126)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149790.1 91126
GRCz11 KN149790.1 91126
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGCCAGAACTCCTAAGCAGGAGGCAGAGGGCCACACTGATAGTGGGAT[T/A]ACGAGCAAAGGTGAGATGTTATGTAATACTGAGGTGGGGGCATGGTAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30446
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113848 Essential Splice Site 169 717 5 9
Genomic Location (Zv9):
Chromosome Zv9_NA915 (position 86295)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149790.1 86295
GRCz11 KN149790.1 86295
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTCTCTCCAGATTGGAGCAACTCCTGCCTGTACCAAACTTCAAACAGG[T/C]CTGATTATACGAGCTTCTCGAATACCTTATCTGAATGATTTACGGGTTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link