si:dkey-72l17.5

Ensembl ID:
ENSDARG00000074821
ZFIN ID:
ZDB-GENE-070424-250
Description:
Novel NACHT domain containing gene [Source:UniProtKB/TrEMBL;Acc:B0S773]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20310 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20310
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111431 Nonsense 258 830 2 6
ENSDART00000134264 Nonsense 303 644 1 1
Genomic Location (Zv9):
Chromosome 4 (position 46082322)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 32017289
GRCz11 4 31983343
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAGCCTCAGAAGGAGGAATATTTCAGGAAGAGAATCAGCAACCAGCAT[C/T]AAGCCAGCAGAATCATCTCCCACATCAGAAGAGCAAGAAGCCTCCAGATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link