si:dkey-253d23.9

Ensembl ID:
ENSDARG00000074820
ZFIN ID:
ZDB-GENE-050208-648
Description:
hypothetical protein LOC100034448 [Source:RefSeq peptide;Acc:NP_001107959]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32378 Nonsense Available for shipment Available now
sa4984 Nonsense F2 line generated During 2018
sa29723 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa32378
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105934 Nonsense 51 428 3 3
ENSDART00000131734 Nonsense 51 168 3 3
Genomic Location (Zv9):
Chromosome 22 (position 10037375)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 9897543
GRCz11 22 9927225
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTGGAGAGAAAAATGACATTAAATCCGCAGAAAAACTGCAGGATCCCT[T/A]ATTGAAAGTAAAAGACAATCTATCTTTCACATGCCTTCAGTGTAAAAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4984
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105934 Nonsense 159 428 3 3
ENSDART00000131734 Nonsense 159 168 3 3
Genomic Location (Zv9):
Chromosome 22 (position 10037050)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 9897218
GRCz11 22 9926900
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACAAAGGTTTGAGGGATCATGTTTGCTCCGAGTGTGGCAAGACCTTTTA[T/A]ACAAAAAGCTGTTTAAAAAATCACCAGWWAGTTCACTCTACAGAAACGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29723
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105934 Nonsense 399 428 3 3
ENSDART00000131734   None 168 None 3
Genomic Location (Zv9):
Chromosome 22 (position 10036332)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 9896500
GRCz11 22 9926182
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAAAAGTCACAATATCTGAAAATACATGAGAAGAGCCACACTGGAGAA[C/T]AGCCATACCAGTGTAATTTATGTGGGAAAAGGTTTACTTATTCTACTTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link