
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-253d23.9
- Ensembl ID:
- ENSDARG00000074820
- ZFIN ID:
- ZDB-GENE-050208-648
- Description:
- hypothetical protein LOC100034448 [Source:RefSeq peptide;Acc:NP_001107959]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa32378 | Nonsense | Available for shipment | Available now |
sa4984 | Nonsense | F2 line generated | During 2018 |
sa29723 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa32378
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000105934 | Nonsense | 51 | 428 | 3 | 3 |
ENSDART00000131734 | Nonsense | 51 | 168 | 3 | 3 |
- Genomic Location (Zv9):
- Chromosome 22 (position 10037375)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 9897543 GRCz11 22 9927225 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGTGGAGAGAAAAATGACATTAAATCCGCAGAAAAACTGCAGGATCCCT[T/A]ATTGAAAGTAAAAGACAATCTATCTTTCACATGCCTTCAGTGTAAAAGGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa4984
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000105934 | Nonsense | 159 | 428 | 3 | 3 |
ENSDART00000131734 | Nonsense | 159 | 168 | 3 | 3 |
- Genomic Location (Zv9):
- Chromosome 22 (position 10037050)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 9897218 GRCz11 22 9926900 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CACAAAGGTTTGAGGGATCATGTTTGCTCCGAGTGTGGCAAGACCTTTTA[T/A]ACAAAAAGCTGTTTAAAAAATCACCAGWWAGTTCACTCTACAGAAACGCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa29723
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000105934 | Nonsense | 399 | 428 | 3 | 3 |
ENSDART00000131734 | None | 168 | None | 3 |
- Genomic Location (Zv9):
- Chromosome 22 (position 10036332)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 9896500 GRCz11 22 9926182 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCAAAAAGTCACAATATCTGAAAATACATGAGAAGAGCCACACTGGAGAA[C/T]AGCCATACCAGTGTAATTTATGTGGGAAAAGGTTTACTTATTCTACTTCT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: