si:dkeyp-23e4.3

Ensembl ID:
ENSDARG00000074819
ZFIN ID:
ZDB-GENE-091118-19
Human Orthologues:
DLC1, STARD13, STARD8
Human Descriptions:
deleted in liver cancer 1 [Source:HGNC Symbol;Acc:2897]
StAR-related lipid transfer (START) domain containing 13 [Source:HGNC Symbol;Acc:19164]
StAR-related lipid transfer (START) domain containing 8 [Source:HGNC Symbol;Acc:19161]
Mouse Orthologues:
Dlc1, Stard13, Stard8
Mouse Descriptions:
deleted in liver cancer 1 Gene [Source:MGI Symbol;Acc:MGI:1354949]
StAR-related lipid transfer (START) domain containing 13 Gene [Source:MGI Symbol;Acc:MGI:2385331]
START domain containing 8 Gene [Source:MGI Symbol;Acc:MGI:2448556]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43690 Nonsense Mutation detected in F1 DNA During 2018
sa23999 Essential Splice Site Available for shipment Available now
sa43689 Nonsense Mutation detected in F1 DNA During 2018
sa29640 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43690
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112308 Nonsense 32 1037 3 16
ENSDART00000138529 Nonsense 22 1030 1 13
Genomic Location (Zv9):
Chromosome 21 (position 34385238)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 35384931
GRCz11 21 35419421
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGCAAAGGAAGCTTGCGATTGGCTTCATGCGGCTGGCTTTCCTCAGTA[T/A]GCACAGTTATTTACTGGTAAGTATTTACTTTTTTAACATTTCTCGATGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23999
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112308 Essential Splice Site 497 1037 None 16
ENSDART00000138529 Essential Splice Site 503 1030 None 13
Genomic Location (Zv9):
Chromosome 21 (position 34383422)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 35383115
GRCz11 21 35417605
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCCAGAAGCATTTGAATGCACTGCTCAGCCTACAGAGCATACTGATCGG[T/C]AAGAGACACCATTTCATTAAGTCTGTTGAAACAAGTCTTATTCTTGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43689
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112308 Nonsense 516 1037 8 16
ENSDART00000138529 Nonsense 509 1030 5 13
Genomic Location (Zv9):
Chromosome 21 (position 34383242)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 35382935
GRCz11 21 35417425
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAAAGAGGTTGCTTGATTTCCTACATTTCAGAATTCAGAGGCCCCACTG[G/A]TCCAGTGCACAGATGCTTTCACTGAGCAGCCCCGGAACAGGCATAGAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29640
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112308 Nonsense 607 1037 9 16
ENSDART00000138529 Nonsense 600 1030 6 13
Genomic Location (Zv9):
Chromosome 21 (position 34374235)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 35373928
GRCz11 21 35408418
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGCTACAGAGTGTCCAGCAGTCGGGGAAGCCTTTGCCACCGAGCATTT[T/A]GAGAGCAATGGAGTTCTTAAGGACCAAGTGCTTAGATCAGGTATGAAATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Intracranial aneurysm: Genome-wide association study of intracranial aneurysm identifies three new risk loci. (View Study)
  • Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
  • Schizophrenia: Genome-wide association study in a Swedish population yields support for greater CNV and MHC involvement in schizophrenia compared with bipolar disorder. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link