Alleles
There are 10 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa45076 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa12853 |
Nonsense |
Available for shipment |
Available now |
sa39635 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa10494 |
Essential Splice Site |
Available for shipment |
Available now |
sa32705 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa16998 |
Essential Splice Site |
Available for shipment |
Available now |
sa39636 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa14854 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa16209 |
Nonsense |
Available for shipment |
Available now |
sa31212 |
Nonsense |
Available for shipment |
Available now |
Mutation Details
- Allele Name:
- sa45076
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 1 (position 32990050)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
1 |
32592230 |
GRCz11 |
1 |
33324798 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACAAAGCCTATCCAAGTGGTCAACTATGCCCTTTGTGTTTCTCCCCAAAA[C/T]AACTAAAGAAGAAACAGCTCCAAGAATTGGAGAAACCCACGTGCAATAGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12853
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 1 (position 32990289)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
1 |
32592469 |
GRCz11 |
1 |
33325037 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- GAATGCCTTGTAATTGAGCMAAGAGAGCTTACYAGCATAGGCTGGGACTA[T/A]GTTMACCAGTACCAAATAWCAGTAAATTTGACTCTTACATTAGATTTGAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39635
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 1 (position 32990653)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
1 |
32592833 |
GRCz11 |
1 |
33325401 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTCTCAGCACCTATATGACTGATGTAATGGAAAGAGAAACCATAAGAAAG[C/T]AGAGTCAAGGCTGGGTCTTAATTGAGTCCAAGAATGACACCAGAACAATG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10494
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 1 (position 32991665)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
1 |
32593845 |
GRCz11 |
1 |
33326413 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- GGTTCGTAGTGGAGGAAATGATACAAAAGCAACTACTCCAARCTATGCTC[A/T]GACCAGTACAAACAAAATACAGGAGTCAGAGMAAAACACAAAGCAGTCAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32705
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 1 (position 32993937)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
1 |
32596117 |
GRCz11 |
1 |
33328685 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACCAGCACAAACATAAGATCAGTAACAGCACATGCCGAGACTAATGCCTA[T/A]TTACCATGTATGGCTGTGGGAAAACCCCATCCCTTCCTTACCTGGACTAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16998
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 1 (position 32995032)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
1 |
32597212 |
GRCz11 |
1 |
33329780 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- GGATMATCTGGAGGACTCCATCTRAAAAGCTTGTGGATGCTCACTACAGG[T/A]AATATAAACACTTCACTGAAGCACATCTCCTTTGCAGGAAAGCACATTCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39636
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 1 (position 32996165)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
1 |
32598345 |
GRCz11 |
1 |
33330913 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGTGACCAGGGTAGAAATCCTTGTCTCTCCACCTGCAATTAATGGCTTC[A/T]AAGGCACCACAAACTCACTGAGAGTGTCTAGTGTTAGAGATCAGAGGAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14854
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 1 (position 32996252)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
1 |
32598432 |
GRCz11 |
1 |
33331000 |
- KASP Assay ID:
- 1641-0476.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- GAGATCAGAGGAAACTGATYGATTGTGACGCTACTGGTACCCCTGCYCCA[C/T]GAGTCATGTGGGTTCTTCCAGAGAATGTTGTACTTCCTGCACCATATTAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16209
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 1 (position 32997058)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
1 |
32599238 |
GRCz11 |
1 |
33331806 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- RTTATTGCATWTCCACCACGTATCACTAGYGRTCCGGCTCCTGCTACCTA[T/A]GCCAAAAGAGGAGTWGCAGTTCAACTTAATTGCTTGGCCATAGGTATCCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa31212
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 1 (position 32997110)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
1 |
32599290 |
GRCz11 |
1 |
33331858 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCAAAAGAGGAGTTGCAGTTCAACTTAATTGCTTGGCCATAGGTATCCCC[A/T]AAGCAGAAGTAGCATGGGAGACCCCCGATCGAACACGGCTTATTGTCAGC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: