
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
dbf4
- Ensembl ID:
- ENSDARG00000074796
- ZFIN ID:
- ZDB-GENE-091020-13
- Description:
- DBF4 homolog [Source:RefSeq peptide;Acc:NP_001128607]
- Human Orthologue:
- DBF4
- Human Description:
- DBF4 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:17364]
- Mouse Orthologue:
- Dbf4
- Mouse Description:
- DBF4 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1351328]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa9288 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa22931 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa9288
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000065643 | Nonsense | 265 | 612 | 9 | 12 |
- Genomic Location (Zv9):
- Chromosome 16 (position 45988810)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 43242103 GRCz11 16 43145861 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TYTTGATGGAGGAACAGGGAAAGGATGACCCAAAGAAGAAACAAAAAGAA[C/T]AAAGGTAGAGCAGAGTCAGTAACAYACCCTATTGAAATCCTCAAGGTTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22931
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000065643 | Essential Splice Site | 306 | 612 | 10 | 12 |
- Genomic Location (Zv9):
- Chromosome 16 (position 45989026)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 43242319 GRCz11 16 43146077 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGGAGGGTACTGTGAGTGCTGCGAGGTCAAATTTGAAAACTTAAAGGCGG[T/C]ATGTGTCAAAATAGAAAGCCACTTTTAATTGAAAATCAAATAGAATAGCT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: