wu:fd99c08

Ensembl ID:
ENSDARG00000074786
ZFIN ID:
ZDB-GENE-030131-4817
Human Orthologue:
RBM16
Human Description:
RNA binding motif protein 16 [Source:HGNC Symbol;Acc:20959]
Mouse Orthologue:
Rbm16
Mouse Description:
RNA binding motif protein 16 Gene [Source:MGI Symbol;Acc:MGI:1925212]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43004 Essential Splice Site Mutation detected in F1 DNA During 2018
sa31015 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43004
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112675 Essential Splice Site 409 1286 11 20
ENSDART00000112675 Essential Splice Site 409 1286 11 20
Genomic Location (Zv9):
Chromosome 17 (position 49167214)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 48854025
GRCz11 17 49011028
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAAAACCAGCAGCACCCGTTCAAGGACGCGCTCAAGATCCCGCTCTAG[G/A]TTGGTGCGCCAATGTCTGTAAAAGGCTCTTTCCATTTTTTTAGCCACAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31015
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112675 Essential Splice Site 409 1286 11 20
ENSDART00000112675 Essential Splice Site 409 1286 11 20
Genomic Location (Zv9):
Chromosome 17 (position 49167214)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 48854025
GRCz11 17 49011028
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAAAACCAGCAGCACCCGTTCAAGGACGCGCTCAAGATCCCGCTCTAG[G/A]TTGGTGCGCCAATGTCTGTAAAAGGCTCTTTCCATTTTTTTAGCCACAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link