si:dkey-85g17.2

Ensembl ID:
ENSDARG00000074759
ZFIN ID:
ZDB-GENE-030131-146
Description:
cell division cycle and apoptosis regulator protein 1 [Source:RefSeq peptide;Acc:NP_001139071]
Human Orthologue:
CCAR1
Human Description:
cell division cycle and apoptosis regulator 1 [Source:HGNC Symbol;Acc:24236]
Mouse Orthologue:
Ccar1
Mouse Description:
cell division cycle and apoptosis regulator 1 Gene [Source:MGI Symbol;Acc:MGI:1914750]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8754 Essential Splice Site Mutation detected in F1 DNA During 2018
sa22266 Nonsense Available for shipment Available now
sa22267 Nonsense Available for shipment Available now
sa35455 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa8754
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109579 Essential Splice Site 488 1194 10 24
ENSDART00000111129 Essential Splice Site 532 1238 11 25
ENSDART00000133057 Essential Splice Site 488 1194 11 25
ENSDART00000138172   None 282 None 7

The following transcripts of ENSDARG00000074759 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 18450100)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18270135
GRCz11 13 18401127
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACAGCAGTGCTGGACCCGCCTGATGCCAATCACACCTACAGTGCAAAG[G/A]TAGAGTCAGCATAATACTTACTTCCACTTCAGAGGATTTTTGACAATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22266
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109579 Nonsense 850 1194 17 24
ENSDART00000111129 Nonsense 894 1238 18 25
ENSDART00000133057 Nonsense 850 1194 18 25
ENSDART00000138172   None 282 None 7

The following transcripts of ENSDARG00000074759 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 18467305)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18287340
GRCz11 13 18418332
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTTCCAACCAAGGATGAGAAGAAGGACAAAAAAGAGAGAGCTAAAAAA[G/T]AGGCCGAAAGAAGGGATATAAAGAAAGAAAGAGATGAAGACAATGGAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22267
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109579 Nonsense 1020 1194 21 24
ENSDART00000111129 Nonsense 1064 1238 22 25
ENSDART00000133057 Nonsense 1020 1194 22 25
ENSDART00000138172   None 282 None 7

The following transcripts of ENSDARG00000074759 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 18476756)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18296791
GRCz11 13 18427783
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGTGAAGAAGTTGTTAAACAAACCTTTGGTTAAAGAGTCGTGCCATTA[T/A]CGAAAGCTGACGGACAGGCCTAAAGATGAGCCTTGCCCCGCACTGATCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35455
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109579 Essential Splice Site 1046 1194 22 24
ENSDART00000111129 Essential Splice Site 1090 1238 23 25
ENSDART00000133057 Essential Splice Site 1046 1194 23 25
ENSDART00000138172   None 282 None 7

The following transcripts of ENSDARG00000074759 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 18476917)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 18296952
GRCz11 13 18427944
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCATTTGTAACAATAGAGCACATATCAATGACAAACTCTCTGTGCCCAC[A/C]GGTAACCAGATTTTACTGACCAGCCAGAAGATCAAGCGAGAGCCAGATGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link