zgc:171813

Ensembl ID:
ENSDARG00000074757
ZFIN ID:
ZDB-GENE-080204-35
Description:
protein ARV1 [Source:RefSeq peptide;Acc:NP_001107083]
Human Orthologue:
ARV1
Human Description:
ARV1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:29561]
Mouse Orthologue:
Arv1
Mouse Description:
ARV1 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1916115]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25130 Essential Splice Site Mutation detected in F1 DNA During 2018
sa36951 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa25130
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113184 Essential Splice Site 72 239 2 5
Genomic Location (Zv9):
Chromosome 20 (position 4088885)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 4031154
GRCz11 20 4000455
KASP Assay ID:
554-7793.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCAAAATCCAGGCGTTTAGGCATATCCTCTTCAACACTGAGATTAATG[T/A]GAGTAAAACTCATTTTTATTCATTAATTTTGCTTCAGCTTAGTCTCTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36951
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113184 Nonsense 194 239 4 5
Genomic Location (Zv9):
Chromosome 20 (position 4084935)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 4027204
GRCz11 20 4004405
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCGCTCTGCTTCAGCCTCATACGACTCTTCGTTCTCACCTCCAATTCA[C/T]AAGCCATACGAGGTGAATATCCTCAAACACCCGCTCTTTTACAATCCACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link