zgc:175094

Ensembl ID:
ENSDARG00000074734
ZFIN ID:
ZDB-GENE-030131-8168
Description:
Male-specific lethal 1-like 1 [Source:UniProtKB/Swiss-Prot;Acc:A9JRX0]
Human Orthologue:
MSL1
Human Description:
male-specific lethal 1 homolog (Drosophila) [Source:HGNC Symbol;Acc:27905]
Mouse Orthologue:
Msl1
Mouse Description:
male-specific lethal 1 homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1921276]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25247 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa25247
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113135 Essential Splice Site 371 489 5 9
Genomic Location (Zv9):
Chromosome 3 (position 23759841)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 23338052
GRCz11 3 23468600
KASP Assay ID:
554-7382.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGTATCTTAGAGCCTTTGGGGCAGAAAGAGGCATCAGACATCCTTGAG[G/T]TAAGATTTGCAGGCTCCACCAAGATGCAGTTCTGCATTCTATGATGGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link