zgc:163016

Ensembl ID:
ENSDARG00000074730
ZFIN ID:
ZDB-GENE-060810-80
Description:
membrane-associated tyrosine- and threonine-specific cdc2-inhibitory kinase [Source:RefSeq peptide;
Human Orthologue:
PKMYT1
Human Description:
protein kinase, membrane associated tyrosine/threonine 1 [Source:HGNC Symbol;Acc:29650]
Mouse Orthologue:
Pkmyt1
Mouse Description:
protein kinase, membrane associated tyrosine/threonine 1 Gene [Source:MGI Symbol;Acc:MGI:2137630]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35234 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35234
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108852 Nonsense 195 554 3 8
ENSDART00000133568 Nonsense 195 240 3 4
ENSDART00000141909 Nonsense 195 554 3 8
Genomic Location (Zv9):
Chromosome 12 (position 15880254)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 14962440
GRCz11 12 15000743
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCCATCTCTACATACAGACTGAACTCTGCTGTACCAGTCTACTGCTATA[T/A]GCCGAGGAAACACCATGTCACACTGGTATGCAAAACACTACATAAGAACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link