zgc:194693

Ensembl ID:
ENSDARG00000074697
ZFIN ID:
ZDB-GENE-031204-31
Description:
neural proliferation, differentiation and control-like [Source:RefSeq peptide;Acc:NP_001122255]
Human Orthologue:
NPDC1
Human Description:
neural proliferation, differentiation and control, 1 [Source:HGNC Symbol;Acc:7899]
Mouse Orthologue:
Npdc1
Mouse Description:
neural proliferation, differentiation and control gene 1 Gene [Source:MGI Symbol;Acc:MGI:1099802]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16483 Nonsense Available for shipment Available now
sa16425 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16483
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111666 Nonsense 129 307 4 9
ENSDART00000111666 Nonsense 129 307 4 9
Genomic Location (Zv9):
Chromosome 21 (position 11916746)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13617920
GRCz11 21 13714649
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCCCCTCCTCTTCAGACTCTGCACCACAGTCTCCTCCGCAAGTACAGT[T/A]GAAGCAGAAAAGTCTTCATAAAACCACAACTGYTGAACCAATGACYRCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16425
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111666 Nonsense 129 307 4 9
ENSDART00000111666 Nonsense 129 307 4 9
Genomic Location (Zv9):
Chromosome 21 (position 11916746)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13617920
GRCz11 21 13714649
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCCCCTCCTCTTCAGACTCTGCACCACAGTCTCCTCCGCAAGTACAGT[T/A]GAAGCAGAAAAGTCTTCATAAAACCACAACTGYTGAACCAATGACYRCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link