
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000074684
- Ensembl ID:
- ENSDARG00000074684
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa15633 | Nonsense | Available for shipment | Available now |
sa22546 | Essential Splice Site | Available for shipment | Available now |
sa32003 | Essential Splice Site | Available for shipment | Available now |
sa22545 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa15633
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000097827 | Nonsense | 117 | 549 | 3 | 15 |
- Genomic Location (Zv9):
- Chromosome 14 (position 49105978)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 47183637 GRCz11 14 46170929 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTGCGACACACAAYGCCTTATAATGGGGCTGAAATCTACTGCGCAAGGGT[T/A]ACAGGTAGGACTCTCTTTTACTATTTAGGTGGTGACAGTTCACCMGAAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22546
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000097827 | Essential Splice Site | 211 | 549 | 6 | 15 |
- Genomic Location (Zv9):
- Chromosome 14 (position 49102916)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 47180575 GRCz11 14 46167867 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAAACTGCTCCTTCAGAACCAGAGTGGGCCTTTTTTCTACTTGTCCAAGG[T/G]CAGATCATTTTACTTGCTTAGAATTTCAACAGGTGTGATCATCGACCACA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32003
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000097827 | Essential Splice Site | 407 | 549 | 11 | 15 |
- Genomic Location (Zv9):
- Chromosome 14 (position 49097800)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 47175459 GRCz11 14 46162751 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGCGTGAAGACATCACTGTGACCCCTAATGACCTGCTCATCATGCCTGCG[G/T]TCAGACAGAATCATCTGAAGATTCAACTTTACTTCATTTATGCAGCACAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22545
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000097827 | Essential Splice Site | 454 | 549 | 13 | 15 |
- Genomic Location (Zv9):
- Chromosome 14 (position 49096350)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 47174009 GRCz11 14 46161301 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTGGGGAAGGTTGAGGATTCAGCAACAGCAGAGATATCCAGATCTCAGG[T/G]CAGTTATTAACAGTTCAGATAAAGTGAAAATGATTAGAAAATGTAATTCT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: