
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
CLCN2 (1 of 2)
- Ensembl ID:
- ENSDARG00000074681
- Description:
- chloride channel 2 [Source:HGNC Symbol;Acc:2020]
- Human Orthologue:
- CLCN2
- Human Description:
- chloride channel 2 [Source:HGNC Symbol;Acc:2020]
- Mouse Orthologue:
- Clcn2
- Mouse Description:
- chloride channel 2 Gene [Source:MGI Symbol;Acc:MGI:105061]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa30445 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa30444 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa30445
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000089279 | Nonsense | 494 | 881 | 14 | 23 |
- Genomic Location (Zv9):
- Chromosome Zv9_NA428 (position 57160)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 KN150171.1 57160 GRCz11 KN150171.1 57160 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAGGGCATCAACACAGACGGCACCATCTATCCCATAGTTCCCGGTGGATA[C/A]GCTGTTGTGGGTAAGAAACGCACACAAACATGGTGTGTGTGTGTGTGCAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa30444
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000089279 | Essential Splice Site | 751 | 881 | 20 | 23 |
- Genomic Location (Zv9):
- Chromosome Zv9_NA428 (position 37763)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 KN150171.1 37763 GRCz11 KN150171.1 37763 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTGTTTTCAGGATGATCCAGACGCAGAGGATGACATGACTCTTGGAGAGG[T/C]GAGGATATTGAAAACCTCTCGTAAATGATGTTGACACGCACACACATAAT
- Associated Phenotype:
- Not determined
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: