
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-14m15.1
- Ensembl ID:
- ENSDARG00000074680
- ZFIN ID:
- ZDB-GENE-090312-135
- Description:
- Novel protein similar to vertebrate regulating synaptic membrane exocytosis 1 (RIMS1) [Source:UniPro
- Human Orthologue:
- RIMS1
- Human Description:
- regulating synaptic membrane exocytosis 1 [Source:HGNC Symbol;Acc:17282]
- Mouse Orthologue:
- Rims1
- Mouse Description:
- regulating synaptic membrane exocytosis 1 Gene [Source:MGI Symbol;Acc:MGI:2152971]
Alleles
There are 8 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa35503 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa1448 | Essential Splice Site | F2 line generated | During 2018 |
sa35502 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa8822 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa42215 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa42214 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa35501 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa42213 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa35503
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000112553 | Nonsense | 327 | 1570 | 6 | 33 |
ENSDART00000131631 | Nonsense | 322 | 963 | 5 | 17 |
ENSDART00000134494 | None | 56 | None | 2 | |
ENSDART00000141035 | None | 182 | None | 5 | |
ENSDART00000142568 | None | 442 | None | 9 |
The following transcripts of ENSDARG00000074680 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 13 (position 27909494)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 27555154 GRCz11 13 27685604 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACAGTCCTGAGACAAGGAGGACAGAGGGGGAGCAGAAACCACCCAGGGAA[C/T]AGTGCAGGACTGACCCAAACGCTCCACATCACCCGGGGAAACTCCGGCCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa1448
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000112553 | Essential Splice Site | 530 | 1570 | 7 | 33 |
ENSDART00000131631 | Essential Splice Site | 525 | 963 | 6 | 17 |
ENSDART00000134494 | None | 56 | None | 2 | |
ENSDART00000141035 | None | 182 | None | 5 | |
ENSDART00000142568 | None | 442 | None | 9 |
The following transcripts of ENSDARG00000074680 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 13 (position 27906024)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 27551684 GRCz11 13 27682134 - KASP Assay ID:
- 554-1374.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGAGAGCAAATGTGTAAACTCTGGGAATTTTATGTGTGTTTGTGTGTTTT[A/G]GGGGACTGGGAGTGCTGTCCACTGGACCCCACTGCGTGGCATGTAAGTAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35502
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000112553 | Nonsense | 563 | 1570 | 8 | 33 |
ENSDART00000131631 | Nonsense | 558 | 963 | 7 | 17 |
ENSDART00000134494 | None | 56 | None | 2 | |
ENSDART00000141035 | None | 182 | None | 5 | |
ENSDART00000142568 | None | 442 | None | 9 |
The following transcripts of ENSDARG00000074680 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 13 (position 27903606)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 27549266 GRCz11 13 27679716 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TACATGGCAGCCCTCCAAAGAAGGTGATCATTTAATTGGCCGAATCACTT[T/A]GAGCAAGAGAACAGCCATGCCAAAAGAGGCTGGGGCTCTGCTAGGGCTAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa8822
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000112553 | Nonsense | 598 | 1570 | 9 | 33 |
ENSDART00000131631 | Nonsense | 593 | 963 | 8 | 17 |
ENSDART00000134494 | None | 56 | None | 2 | |
ENSDART00000141035 | None | 182 | None | 5 | |
ENSDART00000142568 | None | 442 | None | 9 |
The following transcripts of ENSDARG00000074680 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 13 (position 27903201)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 27548861 GRCz11 13 27679311 - KASP Assay ID:
- 2260-6483.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGGTCGGGGGGAAGGTTACAGAAACTGGGAGACTTGGGGYCTTCATCACC[A/T]AAGTCAAGAAAGGAAGTCTAGCTGATGTAGTGGGTCATTTACGGGCTGGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42215
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000112553 | Nonsense | 662 | 1570 | 11 | 33 |
ENSDART00000131631 | Nonsense | 657 | 963 | 10 | 17 |
ENSDART00000134494 | None | 56 | None | 2 | |
ENSDART00000141035 | None | 182 | None | 5 | |
ENSDART00000142568 | None | 442 | None | 9 |
The following transcripts of ENSDARG00000074680 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 13 (position 27899539)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 27545199 GRCz11 13 27675649 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTGAAAAATATCTAATCTTTTTTTCATTCAGTGATATACCAAGAATACCA[G/T]AAACCTCACATCCTCCATTAGAATCAAGTATGTATTCAATCGAATGATAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42214
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000112553 | Nonsense | 782 | 1570 | 14 | 33 |
ENSDART00000131631 | Nonsense | 777 | 963 | 13 | 17 |
ENSDART00000134494 | None | 56 | None | 2 | |
ENSDART00000141035 | Nonsense | 39 | 182 | 2 | 5 |
ENSDART00000142568 | None | 442 | None | 9 |
The following transcripts of ENSDARG00000074680 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 13 (position 27898243)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 27543903 GRCz11 13 27674353 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAAGTCTGGAGCCCAAGTGGAACCAGACGTTTGTGTACTCTCATGTCCAT[C/T]GACGGGACTTCAGAGAGCACATGCTGGAGATTACAGTGTGGGACCAACCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35501
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000112553 | Essential Splice Site | 1204 | 1570 | 27 | 33 |
ENSDART00000131631 | None | 963 | None | 17 | |
ENSDART00000134494 | None | 56 | None | 2 | |
ENSDART00000141035 | None | 182 | None | 5 | |
ENSDART00000142568 | Essential Splice Site | 76 | 442 | 3 | 9 |
The following transcripts of ENSDARG00000074680 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 13 (position 27875194)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 27520854 GRCz11 13 27651304 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTACTCAAATCTAAAATGTTTACAAAGTTTCTGTGTAATTTATTCCATTA[G/T]CTTTATAAGGAGCAGCGAAGGAGTTGTGACAATGTGTCCCATAAGTCCTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42213
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000112553 | Nonsense | 1251 | 1570 | 27 | 33 |
ENSDART00000131631 | None | 963 | None | 17 | |
ENSDART00000134494 | None | 56 | None | 2 | |
ENSDART00000141035 | None | 182 | None | 5 | |
ENSDART00000142568 | Nonsense | 123 | 442 | 3 | 9 |
The following transcripts of ENSDARG00000074680 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 13 (position 27875052)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 13 27520712 GRCz11 13 27651162 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCAGTGCCTCGCGGATCAGTAGCACCAGCTACATGTCCATTCAATCAGAA[C/T]GACCCAGGGGTCGCTTTAGGTGAGATGCACGCTACAGCTATTATTACACA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Cognitive performance: Common genetic variation and performance on standardized cognitive tests. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: