zgc:85889

Ensembl ID:
ENSDARG00000074671
ZFIN ID:
ZDB-GENE-040426-2418
Description:
neuronal pentraxin-1 [Source:RefSeq peptide;Acc:NP_998101]
Human Orthologue:
NPTX1
Human Description:
neuronal pentraxin I [Source:HGNC Symbol;Acc:7952]
Mouse Orthologue:
Nptx1
Mouse Description:
neuronal pentraxin 1 Gene [Source:MGI Symbol;Acc:MGI:107811]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45160 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45160
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100327 Nonsense 135 432 1 5
Genomic Location (Zv9):
Chromosome 3 (position 59931922)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 59178881
GRCz11 3 59471627
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATGGGAGATGTGTCGAGGGGTCCGACCGACACACTGGCGCAACTCTCG[C/T]AGACTTTACAATCGCTGAAGCAGAGGCTCGAAAACCTGGAGGTATGTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link