akt1s1

Ensembl ID:
ENSDARG00000074667
ZFIN ID:
ZDB-GENE-030131-482
Human Orthologue:
AKT1S1
Human Description:
AKT1 substrate 1 (proline-rich) [Source:HGNC Symbol;Acc:28426]
Mouse Orthologue:
Akt1s1
Mouse Description:
AKT1 substrate 1 (proline-rich) Gene [Source:MGI Symbol;Acc:MGI:1914855]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33194 Nonsense Mutation detected in F1 DNA During 2018
sa40083 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa33194
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112739 Nonsense 62 354 1 5
Genomic Location (Zv9):
Chromosome 3 (position 30346058)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30064097
GRCz11 3 30194939
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTGACTGCGTATAAAAAGTTCCATCCATCCGGGATTGAGGTGGAAGGA[C/T]AGAGGAATCATGAAGGAGGTGGGACGTCTGGAAGCAAGAAGTTTGATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40083
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112739 Nonsense 78 354 1 5
Genomic Location (Zv9):
Chromosome 3 (position 30346108)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30064147
GRCz11 3 30194989
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAGGAATCATGAAGGAGGTGGGACGTCTGGAAGCAAGAAGTTTGATTA[T/A]GAATATCATGTATGGGGTCAAGGGGCGTTGGCTGAGTCGTCACGGCGATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link